Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
CircPAN3 | |||
Gene | PAN3 | Organism | Human |
Genome Locus | chr13:28830428-28841538:+ | Build | hg19 |
Disease | Acute Myeloid Leukemia | ICD-10 | Acute megakaryoblastic leukaemia (C94.2) |
DBLink | Link to database | PMID | 30395908 |
Experimental Method | |||
Sample Type | n/a | Comparison | n/a |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward GATTTCCATGCTGGAGGAGA ReverseGGAATGAAGAGGGGAAGACC | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Shang, J, Chen, WM, Wang, ZH, Wei, TN, Chen, ZZ, Wu, WB (2019). CircPAN3 mediates drug resistance in acute myeloid leukemia through the miR-153-5p/miR-183-5p-XIAP axis. Exp. Hematol., 70:42-54.e3. |